rs7414873 chr1:9403195 A>T
- Sequence
ttgttttttgtttttttggttttt[A/T]tgagacggagtttccctctgtcgc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- MEF2B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEF2B_HUMAN | 2.51 | -3.95 | 1.33 | 3.23 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
