rs7417466 chr1:205631849 C>A
- Sequence
ccgcggctcctggcgccccgccct[C/A]cccgcccccgcacgcggcagcggc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MCF-7 C4-12 (invasive breast ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.16 | 1.45 | 1.80 | |||
| MCF-7 C4-12 (invasive breast ductal carcinoma) | -4.20 | 1.68 | 2.00 |
Items per page:
1 – 2 of 2