rs7419021 chr1:214329031 T>C
- Sequence
cgccatcttctggaagcttccgca[T/C]gttgcactgtgagtcagtcattac
- ASB in cell types
- THP-1 (acute monocytic leukemia) A549 (lung carcinoma) erythroid progenitors
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 0.49 | 1.07 | 1.78 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, rheumatoid arthritis, rheumatoid arthritis, combined control dataset, gender differentiated, waist hip ratio
GTEx eQTL Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Skin_Sun_Exposed_Lower_leg