rs742108 - ADASTRA v6.1.1

rs742108 chr6:106135045 G>A

Sequence: aacggagagactctgagtaatgcc[G/A]ggcacggccaccacactcaggctg
ASB in cell types: K562 (myelogenous leukemia)
: Search SNPs nearby
View in UCSC Genome Browser
View in PheLiGe
0.05
FDR threshold
0
ES threshold

Color scale

-log10 FDR of Ref (G) ASB

-log10 FDR of Alt (A) ASB

Details

Transcription factors

Cell types

Cell type	Effect size Ref	Effect size Alt	FDR Ref	FDR Alt	Mean BAD
K562 (myelogenous leukemia)	0.88	-0.04	8.3·10^-4	1.00	2.01

Items per page:

1 – 1 of 1

Motif analysis

No data available

Genetic associations

EMBL-EBI systemic lupus erythematosus

GRASP coronary artery disease (cad), fasting blood glucose, hypertension (early onset hypertension), ldl cholesterol, schizophrenia, systemic lupus erythematosus (sle)