rs7423562 chr2:33047387 A>C
- Sequence
cgttatgtacccggtagtcaattc[A/C]ggagcaggttgttcagtttccatg
- ASB in cell types
- LHSAR (prostate epithelial cells) VCaP (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 1.84 | -0.67 | 1.71 | -1.17 | Weak Concordant | |||
| FOXA1_HUMAN | 2.29 | -4.75 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP alcohol dependence without depressive symptoms, alzheimers disease (apoe3 homozygotes), asthma, comorbid depressive syndrome and alcohol dependence, fasting blood glucose, fasting insulin, hdl cholesterol, homa-ir, imprinting effects on cleft lip without cleft palate, infant head circumference, ldl cholesterol