rs742414 chr20:38169096 A>G
- Sequence
agcagggcctgtgctggctccgcc[A/G]aggttcagaggtcagtcctgtctc
- ASB in cell types
- monocytes from periferal blood monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocytes from periferal blood | 1.56 | -0.02 | 1.00 | |||
| monocyte-derived dendritic cells | 1.92 | -0.23 | 1.14 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Thyroid