rs7424263 chr2:11363225 A>C
- Sequence
ctaagcgtgaaactaaactttctt[A/C]attcatgccctcattcattcattc
- ASB for transcription factors
- ARI1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ARI1B_HUMAN | -1.66 | 2.71 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting blood glucose, hdl cholesterol, height, lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), paternal transmission distortion, refractive error, schizophrenia, total cholesterol, variant creutzfeldt-jakob disease