rs742511 chr6:9413276 C>T
- Sequence
agtcgttccaaaagtatagctaca[C/T]agtgaaatgatctgaattatgttc
- ASB in cell types
- GM18526 (B – cells Lymphoblastoid Cell Lines) GM18505 (female B-cells Lymphoblastoid Cell Lines) GM19239 (male B-cells lymphoblastoid cell line) PANC1 (pancreatic ductal adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18526 (B – cells Lymphoblastoid Cell Lines) | -2.02 | 2.46 | 1.00 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | 1.99 | -1.64 | 1.00 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | -1.44 | 1.83 | 1.00 | |||
| PANC1 (pancreatic ductal adenocarcinoma) | 2.24 | -2.98 | 2.00 |
Items per page:
1 – 4 of 4