rs742600 chr20:50441492 G>A
- Sequence
agcttcagaggctccactacagca[G/A]tttagactctaattacatttactg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) K562 (myelogenous leukemia)
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 1.71 | 0.07 | 3.75 | n/a | No Hit |
Items per page:
1 – 1 of 1