rs742608 chr20:330646 C>T
- Sequence
gcctcttcccctttgtgggctgta[C/T]tgggagtcggtaataggactagaa
- ASB in cell types
- spleen esophagus squamous epithelium
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| spleen | -0.26 | 1.97 | 1.00 | |||
| esophagus squamous epithelium | 0.92 | 2.56 | 1.00 |
Items per page:
1 – 2 of 2