rs7426620 chr3:115381047 C>T
- Sequence
tccaagagggaaggattttgtatg[C/T]gccttgtttagtgctgtatcccca
- ASB in cell types
- bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | 2.15 | -1.95 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, biploar disorder (bipolar schizoaffective disorder), simpson-angus scale, tardive dyskinesia