rs742982 chrX:136212774 A>G
- Sequence
tgcacttcactcgtttccctcctc[A/G]ctcctgttatccctttgcccttct
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.97 | -0.17 | 2.04 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Whole_Blood