rs743302 chr21:34603172 T>C
- Sequence
ttgcctttgatgcctgaaataaag[T/C]gtaagtcaaccagcaagctccact
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) neural cell GM12878 (female B-cells lymphoblastoid cell line) T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa S3 (cervical adenocarcinoma) | 2.42 | 0.22 | 2.00 | |||
| neural cell | -0.20 | 0.83 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.59 | 0.89 | 1.00 | |||
| T47D (invasive ductal carcinoma) | 0.26 | 0.97 | 2.00 | |||
| H929 (plasma cell myeloma) | 1.83 | -1.54 | 1.00 |
Items per page:
1 – 5 of 5