rs7433081 chr3:184503892 T>G
- Sequence
gaagtgcaagagagaaccaggttt[T/G]tctgtcaagcacctttataaggat
- ASB in cell types
- foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -2.57 | 2.79 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, chronic kidney disease, cystatin c in serum, resistance to kuru in aged women despite likely exposure