rs7435424 chr4:143203125 T>C
- Sequence
aacctacagcatttttcagaatgg[T/C]ggcaatgactaagattcctatttt
- ASB in cell types
- LUHMES (lund human mesencephalic cells) GM18526 (B – cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LUHMES (lund human mesencephalic cells) | 1.81 | -1.41 | 1.00 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | 1.74 | -1.44 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, cystatin c in serum, hdl cholesterol, height, serum creatinine, systolic blood pressure (sbp)
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Testis, Thyroid, Whole_Blood