rs7435533 chr4:70652629 A>C
- Sequence
agcctgaccaacatggagaaaccc[A/C]gtcttctactaaaaatacaaaaaa
- ASB in cell types
- MS-1 (Small cell lung carcinoma) neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | 1.72 | -1.25 | 1.00 | |||
| neural cell | -0.90 | 1.58 | 1.00 |
Items per page:
1 – 2 of 2