rs7438414 chr4:94344671 T>C
- Sequence
ttctcccagcccaggtgggggtgc[T/C]ctaactctcctagtcttctaccag
- ASB in cell types
- HUES64 (embryonic stem cells) MS-1 (Small cell lung carcinoma)
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.75 | -1.36 | 1.17 | -0.26 | Weak Concordant | |||
| RAD21_HUMAN | 2.09 | -1.88 | 1.25 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, bipolar disorder, birth weight, fasting blood glucose, ldl cholesterol change with statins, obesity with early age of onset (age >2), rheumatoid arthritis, suicide attempts in major depressive disorder, suicide attempts in mood disorder patients, total cholesterol change with statins, triglycerides change with statins