rs744033 chr2:9984331 G>C
- Sequence
cccctgtcagctcacggggttgaa[G/C]ggtctgaaatgggccagtcttagt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) KMS-11 (Plasma cell myeloma) GBM39 (Human brain tumor)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.51 | 0.80 | 1.12 | |||
| KMS-11 (Plasma cell myeloma) | -2.98 | 1.42 | 2.00 | |||
| GBM39 (Human brain tumor) | -0.08 | 1.20 | 1.00 |
Items per page:
1 – 3 of 3