rs7445050 chr5:76199524 C>T
- Sequence
ttgtctccttggcagcacttacaa[C/T]tgatgcctgaaaatatttacttct
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- FLI1_HUMAN ETS1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FLI1_HUMAN | 2.55 | 0.49 | 1.00 | n/a | No Hit | |||
| ETS1_HUMAN | 2.30 | -1.98 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP decrease in fev1 (in asthmatic participants >=30 years old), lung function, forced expiratory volume in 1 second (fev1) percent predicted (in asthmatic participants)