rs744724 chr4:173538672 T>C
- Sequence
ttggcggcaaaagcgtagatcttg[T/C]cacgattgagaccaatccagtatt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- GATA3_HUMAN RUNX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA3_HUMAN | 3.76 | n/a | 2.00 | -3.49 | Concordant | |||
| RUNX2_HUMAN | 3.16 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, late onset alzheimers disease, prop taste detection threshold