rs744977 chr8:141567837 C>T
- Sequence
gtgggtcagattgacctgagctta[C/T]aggctgggcgtgaagtgcccctgc
- ASB in cell types
- MDA-MB-231ERb(triple negative breast cancer)
- ASB for transcription factors
- ESR2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR2_HUMAN | 1.33 | n/a | 3.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP mitral annular calcium, triglycerides change with statins, urinary albumin-to-creatinine ratio, years of education