rs7454837 chr6:106534767 G>A
- Sequence
tcttttaagcagctggctaatcct[G/A]gcacccatcctcccagaggtgaaa
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.97 | -0.07 | 1.12 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg