rs746321 chr15:54583363 A>T
- Sequence
aaagaatattttcatgtagactgc[A/T]ctaaaataacaagataaacctgaa
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.14 | 0.95 | 1.61 |
Items per page:
1 – 1 of 1