rs74655026 chr1:184982302 G>A
- Sequence
cttgtatttggggaagttagttta[G/A]tgttagtgcacaaagggaagagtg
- ASB in cell types
- HeLa Kyoto (cervical adenocarcinoma) epithelial cell of proximal tubule
- ASB for transcription factors
- PMEPA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PMEPA_HUMAN | -4.39 | 2.56 | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1