rs746720 chr6:20417745 G>T
- Sequence
ttaattacagccatgttaaaaggg[G/T]tgtttgggacggtttggtagttcc
- ASB for transcription factors
- ETS1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ETS1_HUMAN | -1.66 | 1.66 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP height, hypertension (early onset hypertension), ldl cholesterol, rheumatoid arthritis, serum creatinine, sporadic creutzfeldt-jakob disease, tetrology of fallot