rs746787 chr8:66512443 C>G
- Sequence
gaaggtgcccttgaccgggaattt[C/G]cagcaattttaggaatgtggtgac
- ASB in cell types
- HMEC (human mammary epithelial cells) GM19238 (female B-cells lymphoblastoid cell lines) GM02255 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HMEC (human mammary epithelial cells) | 1.98 | -0.11 | 1.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | 1.81 | -0.72 | 1.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | -0.91 | 1.62 | 1.00 |
Items per page:
1 – 3 of 3