rs746816 chr13:59438053 T>C
- Sequence
tatcaccttgtgaaacttcccctt[T/C]tatttttcatcacttccttcttta
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CTV-1 (Adult T acute lymphoblastic leukemia) | -0.31 | 1.07 | 1.50 | |||
| monocyte-derived dendritic cells | -1.46 | 2.50 | 2.00 |
Items per page:
1 – 2 of 2