rs748915 chr5:171509085 C>T
- Sequence
tgcgaggccctgaaagtaacagta[C/T]ggtgggctgggaggccagtggccc
- ASB in cell types
- iPS-derived chondrocytes
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| iPS-derived chondrocytes | -0.24 | 1.19 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, adiponectin levels, comorbid depressive syndrome and alcohol dependence, eye color, obesity with early age of onset (age >2), schizophrenia, spine bone mineral density (bmd), years of education