rs749226 chr1:160078884 A>G
- Sequence
catccctgagatgatggtgatgac[A/G]gtgacaatgatgatgaccatgaag
- ASB in cell types
- erythroid cells GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | -0.35 | 2.01 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Hippocampus, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Colon_Transverse, Muscle_Skeletal, Nerve_Tibial, Spleen, Stomach, Testis, Whole_Blood