rs749702 chr19:38699255 C>T
- Sequence
tagccgggcaccaccaggaggctg[C/T]gtgccctgtgcttgggtgtaccca
- ASB in cell types
- foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.77 | -5.32 | 2.83 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, homa-b
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Left_Ventricle, Minor_Salivary_Gland, Muscle_Skeletal, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood