rs751437 chr8:127853971 G>T
- Sequence
tgctctgtcctgccctttctgtac[G/T]gcgttttctcttcccggctcctct
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.37 | 0.06 | 2.00 | 0.21 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP birth weight, cystatin c in serum, hip bone mineral density (bmd), homa-b, neuroblastoma (brain cancer), serum creatinine, urinary albumin-to-creatinine ratio