rs751510 chr11:72471508 G>A
- Sequence
gcacctcgcttcaaaactgcctgc[G/A]cttccaactcgtgctcggcttctg
- ASB in cell types
- erythroid cells foreskin keratinocyte neutrophils from periferal blood THP-1 (acute monocytic leukemia)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 0.04 | 0.98 | 1.00 | 1.02 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
