rs751707 chr11:44775537 G>C
- Sequence
ggtcctctccaggcacgtttcatt[G/C]ccagcctccttctgggagcctccg
- ASB in cell types
- K562 (myelogenous leukemia) GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 1.10 | 0.25 | 2.06 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | 0.91 | -0.62 | 1.17 |
Items per page:
1 – 2 of 2