rs751715 chr1:244801411 T>C
- Sequence
gcactggcactgatgaaaggggga[T/C]gctaaatgcttcagtaacgccacc
- ASB in cell types
- THP-1 (acute monocytic leukemia) LNCaP (prostate carcinoma) GM02255 (Lymphoblastoid Cell Lines) tibial nerve
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.66 | 0.83 | 1.22 | n/a | No Hit | |||
| RAD21_HUMAN | 0.82 | 0.95 | 1.15 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, fasting insulin, homa-ir, partial epilepsy, refractive error, sporadic creutzfeldt-jakob disease, tetrology of fallot