rs752474 chr7:20402840 G>C
- Sequence
ctgccacctacaggttagattcca[G/C]aaaatctaatcaacattagcaaac
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) foreskin keratinocyte GBM39 (Human brain tumor)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.82 | 0.41 | 1.41 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, height, major depressive disorder (broad definition) (males), major depressive disorder (narrow definition) (males), obesity with early age of onset (age >2), waist hip ratio