rs752503 chr19:33241688 C>T
- Sequence
tgggtgaggcccggagagccggca[C/T]gggggcgggggaccgtgagaacca
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) GM02610 (Lymphoblastoid Cell Lines) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa S3 (cervical adenocarcinoma) | 2.06 | -1.14 | 2.33 | |||
| GM02610 (Lymphoblastoid Cell Lines) | -0.83 | 0.82 | 1.00 | |||
| HEK293 (embryonic kidney) | 0.45 | 0.95 | 4.53 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP fasting blood glucose, hypertension (early onset hypertension), ldl cholesterol, mitral annular calcium, partial epilepsy