rs753562 chr3:64151695 A>G
- Sequence
ggcaatactgagtcaagacattgc[A/G]ccattttccctgacactgtcctac
- ASB in cell types
- SU-DHL-1 (Anaplastic large cell lymphoma) JB6 (Human anaplastic large cell lymphoma) MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | 0.52 | 2.01 | 2.40 | 3.42 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP alzheimers disease, irritible bowel syndrome, maternal transmission distortion, mitral annular calcium, systolic blood pressure (sbp), tourettes syndrome, transmission distortion