rs7536906 chr1:93407238 G>A
- Sequence
aggtccactccagaccctgtttgc[G/A]tgggtatcagcagtggaggctgca
- ASB in cell types
- embryonic stem cells
- ASB for transcription factors
- ZN486_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN486_HUMAN | 1.94 | -0.43 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Nerve_Tibial, Spleen, Testis, Thyroid, Whole_Blood