rs754093 chr18:79486406 T>G
- Sequence
tgcctcgtggccggcttcccgccc[T/G]gtccgcagagaagcaccctgatgc
- ASB in cell types
- HS-SY-2(Monophasic synovial sarcoma)
- ASB for transcription factors
- Q8IZH1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| Q8IZH1_HUMAN | -0.99 | 1.70 | 1.67 | n/a | n/a |
Items per page:
1 – 1 of 1