rs75438587 chr1:10793989 T>C
- Sequence
caccaggacgcaaacccggcgctt[T/C]gcgctcgggcgccgaacggcccag
- ASB in cell types
- NGP (neuroblastoma)
- ASB for transcription factors
- MYCN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MYCN_HUMAN | 2.35 | -2.35 | 1.50 | 3.49 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
