rs7544736 chr1:96698787 A>G

Sequence
gttttctttgtgtttatcaggctt[A/G]atgttatttgagttctgggatctg
ASB in cell types
BE2C
ASB for transcription factors
HAND2_HUMAN

Color scale

color scale ref
-log10 FDR of Ref (A) ASB
color scale alt
-log10 FDR of Alt (G) ASB

Details

Uniprot ID
Effect size Ref
Effect size Alt
FDR Ref
FDR Alt
Mean BAD
Motif fold change
Motif concordance
HAND2_HUMAN 2.40 -4.28 0.011.00 1.50 n/a No Hit
Items per page:
1 – 1 of 1

Motif analysis

No data available

Genetic associations

EMBL-EBI schizophrenia
GRASP rheumatoid arthritis schizophrenia
PheWAS abdominal hernia anemia in neoplastic disease anterior pituitary disorders aphakia and other disorders of lens aseptic necrosis of bone barretts esophagus benign neoplasm of respiratory and intrathoracic organs cardiac arrest deficiency anemias nos derangement of joint, non-traumatic diaphragmatic hernia diseases of blood and blood-forming organs disorders of optic nerve and visual pathways dysthymic disorder epiphora generalized convulsive epilepsy genu valgum or varum (acquired) gram positive septicemia hearing loss hemiplegia herpes zoster with nervous system complications hyperosmolality and/or hypernatremia hypersomnia hypertensive heart and/or renal disease hypertensive heart disease hypoventilation insect bite iron metabolism disorder joint effusions kidney replaced by transpant meningitis mixed hyperlipidemia oliguria and anuria open wound of hand except finger(s) optic neuritis/neuropathy osteoarthrosis osteoarthrosis nos other congenital anomalies of skin other derangement of joint other disorders of arteries and arterioles other disorders of bone and cartilage other disorders of eye other disorders of intestine pernicious or b12 deficiency anemia phlebitis and thrombophlebitis of lower extremities proteinuria pyogenic granuloma renal colic stricture of artery throat pain toxic effect of venom transient alteration of awareness ulcer of esophagus urethral stricture (not specified as infectious)
GTEx eQTL Pancreas

Download