rs7551992 chr1:40338645 C>G
- Sequence
ccaggctgatctcgaactccaggc[C/G]tcatgtgatccacctgcctctgcc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- RAD51_HUMAN USF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD51_HUMAN | n/a | 3.63 | 1.00 | n/a | n/a | |||
| USF2_HUMAN | -2.34 | 2.29 | 1.00 | 1.16 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Esophagus_Muscularis, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Testis