rs75570 chr1:41783308 A>G
- Sequence
gcagagaggattcattccgtattc[A/G]ttcccctagtgagccacacgcttc
- ASB in cell types
- HEK293 (embryonic kidney) CTV-1 (Adult T acute lymphoblastic leukemia) HCT-116 (colon carcinoma)
- ASB for transcription factors
- SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA4_HUMAN | -0.23 | 1.79 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1