rs757090 chr11:2419678 C>T
- Sequence
tggccttgccaagaaattacaatt[C/T]tgtttctaaatattgtatattgtt
- ASB in cell types
- neutrophils from periferal blood MS-1 (Small cell lung carcinoma) LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils from periferal blood | -0.24 | 2.62 | 2.00 | |||
| MS-1 (Small cell lung carcinoma) | -0.38 | 0.61 | 1.00 | |||
| LNCaP (prostate carcinoma) | -0.87 | 1.15 | 1.00 |
Items per page:
1 – 3 of 3