rs757654 chr14:72514209 T>C
- Sequence
ccgggaactaaaccaagtttaagc[T/C]ctgctgcctacgtctctggttgac
- ASB in cell types
- A549 (lung carcinoma) HeLa S3 (cervical adenocarcinoma) GM19099 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.28 | 0.98 | 2.00 | |||
| HeLa S3 (cervical adenocarcinoma) | 0.23 | 1.30 | 2.00 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 0.67 | -0.65 | 1.00 |
Items per page:
1 – 3 of 3