rs757900 chr7:74417562 T>C
- Sequence
gtcttgcctgtgatgcctcccatt[T/C]accagcaggtgtcaccctcggccc
- ASB in cell types
- K562 (myelogenous leukemia) MS-1 (Small cell lung carcinoma) erythroid cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.55 | 0.73 | 1.22 | |||
| MS-1 (Small cell lung carcinoma) | -0.06 | 0.39 | 1.00 | |||
| erythroid cells | 1.58 | n/a | 5.00 |
Items per page:
1 – 3 of 3