rs75984857 chr6:79762560 C>G
- Sequence
tccagacctcgccttccttgccca[C/G]agggactgaagcctatttctttat
- ASB in cell types
- neural cell GM02255 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | -0.20 | 1.73 | 1.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | -1.78 | 2.24 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia