rs75989943 chr12:120087042 G>A
- Sequence
gcaacgttagtcagcacattcctg[G/A]ggctcccgctgctctcggcgccac
- ASB in cell types
- epidermal keratinocytes upper lobe of left lung kidney
- ASB for transcription factors
- TEAD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TEAD4_HUMAN | 0.98 | -0.98 | 1.00 | -1.06 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Coronary, Brain_Cerebellum, Breast_Mammary_Tissue, Liver, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid