rs75990459 chr22:22848505 G>A
- Sequence
ctggtccgcaccctcccaggtgac[G/A]ggtgctctgggatcacctggagaa
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | 1.26 | n/a | 1.50 | |||
| neural cell | -0.03 | 2.24 | 2.00 |
Items per page:
1 – 2 of 2