rs76014889 chr12:123801765 C>T
- Sequence
aagaattacgacagagggagcctt[C/T]gtaccctttagtcattttccctaa
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | -2.35 | 0.63 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Nerve_Tibial, Prostate, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum